DNA hybridization calculator

DNA Hybridization Calculator

Calculation Mode

DNA Sequence ATGCGTACGTAGCTAGCTAGCTAGCTAGCTAGC Only A, T, G, C accepted. Case-insensitive.

DNA Type Double-stranded (dsDNA) Single-stranded (ssDNA)

Salt Concentration (Na+) M Typical hybridization buffer: 0.05 M (50 mM).

Probe Concentration µM Typical probe concentration: 0.1-0.5 µM.

Probe / Primer Tm Celsius

Target Tm Celsius Melting temperature of the target region (optional).

Hybridization Temperature Celsius

Salt Concentration (Na+) M

Melting Temperature (Tm)

0.0 Celsius

GC Content

0%

Length

0 nt

Stringency Assessment

—

—

Additional Info —

Step-by-Step Calculation

Click Calculate to see the detailed step-by-step analysis.

© 2026 DNA Hybridization Calculator Tool. All rights reserved. Calculators arena.

  

👉👉 Use instant tool : DNA replication calculator

Complete Guide to DNA Hybridization

Introduction

DNA hybridization is the process by which two complementary single-stranded DNA molecules anneal to form a double-stranded molecule. This fundamental technique is the basis of many molecular biology applications, including Southern blotting, Northern blotting, microarray analysis, quantitative PCR (qPCR), and next-generation sequencing (NGS) library preparation. The DNA Hybridization Calculator helps researchers determine the melting temperature (Tm) of probes and primers, assess hybridization stringency, and optimize experimental conditions.

What is DNA Hybridization?

Hybridization occurs when complementary DNA strands recognize and bind to each other through hydrogen bonding between base pairs (A-T and G-C). The stability of the hybrid depends on the sequence, length, salt concentration, and temperature. The key parameter is the melting temperature (Tm) – the temperature at which 50% of the duplex dissociates into single strands.

• Melting Temperature (Tm): The temperature at which half of the DNA duplex is denatured.
• Stringency: The degree of specificity of hybridization, determined by temperature and salt concentration.
• Hybridization Temperature: The temperature at which the hybridization reaction is performed.

Why is Hybridization Important?

Hybridization is a cornerstone of molecular biology: probe design, PCR primer design, microarray analysis, NGS library preparation, and diagnostic assays all rely on accurate Tm and stringency calculations.

How to Use the DNA Hybridization Calculator

The tool offers two modes:

Mode 1: Melting Temperature (Tm)

Enter a DNA sequence to calculate its Tm, GC content, and length. Select whether it is single-stranded (ssDNA) or double-stranded (dsDNA) for accurate calculations.

Mode 2: Hybridization Stringency

Enter the probe Tm, target Tm (optional), hybridization temperature, and salt concentration to assess the stringency of hybridization.

Typical Tm Ranges

Application	Typical Tm Range (Celsius)	Recommended Ta (Celsius)
PCR Primers (20-30 nt)	55-65	50-60
qPCR Probes	60-70	55-65
Microarray Probes	50-65	45-55
Hybridization Capture Probes	65-75	60-70

Stringency and Its Effects

Stringency is the degree of specificity required for hybridization. Higher stringency reduces non-specific binding but may reduce yield. Key factors:

• High Stringency (Tm - Ta >= 10 Celsius): Excellent specificity, ideal for discriminating single-base mismatches.
• Moderate Stringency (Tm - Ta = 5-10 Celsius): Balanced specificity and yield, suitable for most applications.
• Low Stringency (Tm - Ta < 5 Celsius): Maximum binding, may allow mismatches.

Conclusion

The DNA Hybridization Calculator is an essential tool for researchers working with nucleic acid probes, primers, and hybridization assays. By providing Tm calculation and stringency assessment, it supports experimental design and optimization.

Note: The calculator uses the nearest-neighbor method (SantaLucia, 1998) for dsDNA and the Wallace rule with salt correction for ssDNA. For the most accurate results, use the nearest-neighbor method for sequences >20 nt.